For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = ~694 bp
Heterozygote = ~694 bp and 719 bp
Wild type = 719 bp
chr9:75097728+75098446 719bp TCAAGGATGGGATAAATGGAGACT CCAAGCCCAAGTTTATGGAGTG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73116 | CCA AGC CCA AGT TTA TGG AGT G | Wild type Reverse | A | Intron between Myo5a exon 30 & 31 | ||
| 73117 | TCA AGG ATG GGA TAA ATG GAG ACT | Common | A | Intron between Myo5a exon 30 & 31 | ||
| 73118 | CAC AAA GAC AGA GAC GGA GAC A | Mutant Reverse | A | Emv3 between 5''-LTR & gag |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 73116 | 0.50 uM |
| 73117 | 0.50 uM |
| 73118 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 000285 | B6.Cg-Rorasg + +/+ Myo5ad Bmp5se/J |
| 012889 | B6N;TKDU-Myo5ad Cacna2d2du/J |
| 000963 | DBA/2J-Myo5ad+17J/Myo5ad/J |
| 000964 | DBA/2J-Myo5ad+18J/Myo5ad/J |
| 000067 | DBA/2J-Myo5ad+2J/Myo5ad/J |
| 000994 | STOCK a Myo5ad Mregdsu/J |
| 000286 | STOCK a/a Myo5ad fd/+ +/J |
| 000390 | STOCK Myo5ad Ds/J |
| 8 strains use this protocol | |