Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 149 bp
Wild Type = 149 bp
Ref Seq: GTGCAATGATAATTTCTCAGGACACAACT(G/A)TGGGACTTGCCGTCCTGGGTGGA
Mut = A
WT= G
>chr4:80835311+80835459 149bp CCCCACGATGGTAAAGATGA CCTGTGAGAATTTTCTGGTTGC
Wt Sequence:
Mutant Sequence:
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 29465 | CCC CAC GAT GGT AAA GAT GA | Forward | A | |||
| 29466 | CCT GTG AGA ATT TTC TGG TTG C | Reverse | A | |||
| 36484 | Fluorophore-1 | ACA CAA CTG TGG GAC TTG CC | Quencher-1 | WT Probe | ||
| 36485 | Fluorophore-2 | AGG ACA CAA CTA TGG GAC TTG C | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 29465 | 0.40 uM |
| 29466 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
| Stock Number | Strain Name |
|---|---|
| 000571 | B6.Cg-Whrnwi Tyrp1b/+ +/J |
| 000027 | B6.D-Tyrp1b Dock7m/J |
| 001045 | SI/Col Tyrp1b Dnah11iv/J |
| 000064 | STOCK a Tyrp1b Pmelsi/J |
| 002238 | STOCK a Tyrp1b shmy/J |
| 001432 | STOCK a/a Tyrp1b Ndc1sks/Tyrp1b +/J |
| 002142 | STOCK 11R30m/J |
| 000594 | STOCK T(2;8)26H a/T(2;8)26H a Tyrp1+/Tyrp1b/J |
| 001101 | STOCK T(3;4)5Rk Tyrp1b/J |
| 9 strains use this protocol | |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.