For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 149 bp
Wild Type = 107 bp
>chrX:92838863-92838969 107bp GAAACAGGCATGATCAGTCA CTCAAGAGTTTTTATAACTGAATGGA
Sequence
Wt Sequence:
tagtgacgaagaaacaggcatgatcagtcatatagaaaagtcattgagaacttgaacataGACGGGTCTCCCTCTGGAGTCTGTCCTATTATCCATTCAGTTATAAAAACTCTTGAGAACTTTAGGAT
Mutant Sequence:
acgaagaaacaggcatgatcagtcatatagaaaagtcattgagaacttgaacatACttagatctgtcagtggctaatagtctctatgatgacatgttatgtaagaagaatgatgagatgaagattaatgtaagagttttacctatgcactggcat
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46232 | GAA ACA GGC ATG ATC AGT CA | Common | A | |||
| 46233 | CTC AAG AGT TTT TAT AAC TGA ATG GA | Wild type Reverse | A | |||
| 46246 | Fluorophore-1 | ACG GGT CTC CCT CTG GAG T | Quencher-1 | WT Probe | ||
| 46247 | TGC CAG TGC ATA GGT AAA ACT C | Mutant Reverse | A | |||
| 46249 | Fluorophore-2 | TGA GAA CTT GAA CAT ACT TAG ATC TGT CAG T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46232 | 0.40 uM |
| 46233 | 0.40 uM |
| 46247 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.