Protocol 51017: Standard PCR Assay - Gt(ROSA)26Sor<em#(CAG-GFP)Msasn>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = ~210 bp
Heterozygote = ~210 bp and 387 bp
Wild type = 387 bp

chr6:113075851-113076237 387bp CCAAAGTCGCTCTGAGTTGTT CCAGATGACTACCTATCCTCC

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
13611 GGA CAC GCT GAA CTT GTG G Mutant Reverse A eGFP
56815 ATC CCC ATC AAG CTG ATC C Mutant Forward A LSL
74518 CCA AAG TCG CTC TGA GTT GTT Wild type Forward A ROSA26
75116 CCA GAT GAC TAC CTA TCC TCC Wild type Reverse A ROSA26

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
13611 0.50 uM
56815 0.50 uM
74518 0.50 uM
75116 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
033734 C57BL/6J-Gt(ROSA)26Sorem2(CAG-GFP,-Farsa*T413G)Msasn/J
033735 C57BL/6J-Gt(ROSA)26Sorem3(CAG-GFP,-Yars1*Y43G)Msasn/J
2 strains use this protocol