C57BL/6J-Gt(ROSA)26Sor^{em2(CAG-GFP,-Farsa*T413G)Msasn}/J

Stock number: 033734
Product name: PheRS
Strain synonyms: Rosa CAG-LSL-GFP-MmFARSA-T413G KI
Research areas: Neurobiology Research, Research Tools

Description

This Rosa CAG-LSL-GFP-MmFARSA-T413G KI (PheRS*) strain enables genetically targeted (Cre-dependent) metabolic labeling of noncanonical amino acids in specific cell-types in vivo for subsequent imaging or purification and biochemical analysis.

Detailed description

The T413G point mutation in phenylalanyl-tRNA synthetase results in an altered binding site that enables loading of non-canonical amino-acid phenylalanine analogs, such as p-azido-L-phenylalanine (AzF), onto phenylalanine tRNA. As endogenous wildtype phenylalanyl-tRNA synthetase does not bind AzF, expression of the mutant PheRS (PheRS*) allows the incorporation of AzF into nascent proteins which can then be subsequently labeled by with fluorophores for imaging or affinity resins for mass spectrometric characterization. Rosa CAG-LSL-GFP-MmFARSA-T413G KI (PheRS*) mice have a CRISPR-generated knock-in of a floxed STOP cassette, GFP, P2A sequence and mutant Farsa sequence, all under the control of a CAG promoter, into the endogenous Gt(ROSA)26Sor locus. The P2A sequence enables expression of the GFP and mutant Farsa as discrete translation products from the same single promoter. Following Cre recombinase mediated removal of the floxed STOP cassette, GFP expression and AzF incorporation are only detected in cells expressing the mutant phenylalanyl-tRNA synthetase, PheRS* (Farsa*). Mice that are homozygous for the knock-in allele are viable and fertile.

When bred to a strain with Olig2-Cre mice (see Stock No. 025567), with Cre recombinase expression in oligodendrocyte-lineage cells and motor neurons, this mutant mouse strain is useful in studies of nascent proteins and protein synthesis in astrocytes and oligodendrocytes cells.

Of note, strains containing mutant aminoacyl-tRNA synthetases that recognize azide-bearing noncanonical amino acids include:
MetRS* (Stock No. 028071)
PheRS* (Stock No. 033734)
TyrRS* (Stock No. 033735).

Development

sgRNAs (ACTGGAGTTGCAGATCACGA and GCAGATCACGAGGGAAGAGG) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette containing 3xSV40 polyadenlyation signals, an EGFP sequence, a viral 2A oligopeptide (P2A) self-cleaving peptide, that mediates ribosomal skipping, and a mutant phenylalanyl-tRNA synthetase, alpha subunit (Farsa) gene into the Gt(ROSA)26Sor locus. The Farsa gene contains a threonine to glycine mutation at amino acid 413 (T413G). gRNA, the cas9 mRNA, and a donor plasmid were introduced into the cytoplasm of C57BL/6J-derived fertilized eggs with well recognized pronuclei. Injected embryos were transferred to pseudopregnant females. Surviving embryos were transferred to pseudopregnant females. Resulting Rosa CAG-LSL-GFP-MmFARSA-T413G KI (PheRS*) progeny were screened by DNA sequencing to identify correctly targeted pups, which were then bred to C57BL/6J mice (Stock No. 000664) for germ line transmission. This Rosa CAG-LSL-GFP-MmFARSA-T413G KI colony was backcrossed to C57BL/6J mice for at least 3 generations. Upon arrival at The Jackson Laboratory, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize C57BL/6J oocytes.

Allele

Symbol: Gt(ROSA)26Sor^{em2(CAG-GFP,-Farsa*T413G)Msasn}
Name: endonuclease-mediated mutation 2, Michael Sasner
MGI accession ID: MGI:7711614
Generation method: Endonuclease-mediated
Attributes: Conditional ready (e.g. floxed); Reporter; Inserted expressed sequence
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: C57BL/6J
Molecular note: sgRNAs (ACTGGAGTTGCAGATCACGA and GCAGATCACGAGGGAAGAGG) were designed to insert a cassette encoding a CMV-IE enhancer/chicken beta-actin/rabbit beta-globin hybrid promoter (CAG) followed by a floxed STOP cassette containing 3xSV40 polyadenlyation signals, an EGFP sequence, a viral 2A oligopeptide (P2A) self-cleaving peptide, that mediates ribosomal skipping, and a mutant phenylalanyl-tRNA synthetase, alpha subunit (Farsa) gene into the Gt(ROSA)26Sor locus. The Farsa gene contains a threonine to glycine mutation at amino acid 413 (T413G).