Protocol 48987: Standard PCR Assay - Igk<em1(IGK*)Abtx> Alt2
Version 3.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = ~271 bp
Heterozygote = ~271 bp and 148 bp
Wild type = 148 bp

 
chr6:70701871+70702018 148bp GCAACCTCTTCTTTACAACTG GGCTCTGTTCCTATCACTG

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
74554 GCA ACC TCT TCT TTA CAA CTG Wild type Forward A Igk/chr6
74555 GGC TCT GTT CCT ATC ACT G Common A Igk/chr6
74556 AGT ATG TTC TTT CAT TAT CCT CTG T Mutant Forward A IgK (human)

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
74554 0.50 uM
74555 0.50 uM
74556 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.