For in-depth product & services help, ask our
Technical Information Scientists
Notes
JR 39143 Mut = caggaattataatgcttatct
JR 39144 Mut = cttgaagatattcaccattat
JR 39145 Mut = acttgacgatacagctaattc
This is an absence presence assays to detect the point mutations and will not distinguish hemi from hom
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
SEQ
cacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaatgacgtacggcggccgcctcgactagggataacagggtaattgtttgaatgaggcttcagtactttacagaatcgttgcctgcacatcttggaaacacttgctgggattacttcgacttcttaacccaacagaaggctcgagaaggtatatTGCTGTTGACAGTGAGCG(caggaattataatgcttatct/cttgaagatattcaccattat/acttgacgatacagctaattc)ATAGTGAAGCCACAGATGTATagATaAGcatTATaaTtcctATGCCTACTGCCTCGGActtcaaggggctagaattcgagcaattatcttgtttactaaaactgaataccttgctatctctttgatacatttttacaaagctgaattaaaatggtataaattaaatcacttttttcaattgacgcgttgagaacttcagggtgagtttggggacccttgattgttctttctttttcgctattgtaaaattcatgttatatggagggggcaaagttttcag
Other mismatches may be present - but the targeted SNPs/shRNA sites are in Red.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 30567 | GAT CAC TCT CGG CAT GGA | Forward | A | |||
| 73710 | AAG TTC TCA ACG CGT CAA TT | Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 30567 | 0.50 uM |
| 73710 | 0.50 uM |
| Glycerol | 6.50 % |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 039143 | B6;129-Gt(ROSA)26Sortm2(CAG-rtTA3,-mKate2)Slowe Krastm4Tyj Trp53tm1Brn Col1a1tm1(tetO-GFP/RNAi:rluc)Ttam/TtamJ |
| 039144 | B6;129-Gt(ROSA)26Sortm2(CAG-rtTA3,-mKate2)Slowe Krastm4Tyj Trp53tm1Brn Col1a1tm2(tetO-GFP/RNAi:Kras462)Ttam/TtamJ |
| 039145 | B6;129-Gt(ROSA)26Sortm2(CAG-rtTA3,-mKate2)Slowe Krastm4Tyj Trp53tm1Brn Col1a1tm3(tetO-GFP/RNAi:Kras247)Ttam/TtamJ |
| 3 strains use this protocol | |