B6;129-Gt(ROSA)26Sor^{tm2(CAG-rtTA3,-mKate2)Slowe} Kras^tm4Tyj Trp53^tm1Brn Col1a1^{tm2(tetO-GFP/RNAi:Kras462)Ttam}/TtamJ

Stock number: 039144
Product name: KP; RIK; TET-GFPshKras462
Research areas: Cancer Research, Research Tools

Description

These TET-GFPshKras462 mice contain the Cre-inducible Kras^LSL-G12D, Rosa26-CAGs-LSL-RIK knock-in, and p53^flox targeted mutations and a novel Col1a1 mutation with tetracycline-responsive elements (TRE) driving expression of GFP fused to RNAi:Kras462 shRNA targeting base pairs starting at 462 in the KRAS transcript. This strain is a cre- and doxycycline-inducible model useful when studying KRAS inhibition and therapeutic strategies to overcome resistance to KRAS-targeted cancer therapies.

Detailed description

These KP; RIK; TET-GFPshKras462 mice contain the Cre-inducible Kras^LSL-G12D, Rosa26-CAGs-LSL-RIK knock-in, and p53^flox targeted mutations and a novel Col1a1 mutation with tetracycline-responsive elements (TRE) driving expression of GFP fused to RNAi:Kras462 shRNA targeting base pairs starting at 462 in the KRAS transcript.

Breeding to mice expressing Cre recombinase or viral delivery of Cre recombinase leads to the expression of oncogenic Kras^G12D and deletion of Trp53 and the expression of rtTA3 and mKate2 fluorescence. Upon systemic administration of doxycycline (dox) to the Cre-recombined mice, rtTA3 will bind to TRE, resulting in the expression of a GFP-linked shRNA targeting Kras in the Cre-expressing cells. In these mice, mKate2 and GFP are detectable by fluorescence and immunostaining. The donating investigator reports no GFP expression is evident prior to dox administration.

After adenoviral delivery of Cre recombinase under the control of an AT2 cell-specific surfactant protein C (Sftpc) promoter, expression of oncogenic Kras^G12D and deletion of Trp53 in these KP; RIK; TET-GFPshKras462 mice results in the development of lung adenocarcinoma (LUAD). Upon systemic administration of dox, mice will express the GFP-linked shRNA targeting Kras specifically in the LUAD cells. Kras is the most commonly mutated proto-oncogene and has been found to be primarily activated in human tumors in pancreatic, colon, and lung cancer. Direct inhibition of KRAS mutations results in lower than expected patient response and recovery due to acquired resistance involving activation of parallel signaling pathways that bypass KRAS, lineage transformation, or drug-desensitizing mutations in KRAS itself.

This strain is useful when studying KRAS inhibition and therapeutic strategies to overcome resistance to KRAS-targeted cancer therapies. A control line is available as Stock No. 039143 and a companion strain containing shRNA targeting base pairs starting at 247 in the KRAS transcript is available as Stock No. 039145.

Rosa26-CAGs-LSL-RIK knock-in, p53^LoxP, and TET- GFPshKras462 alleles may be kept homozygous, while the Kras^LSL-G12D allele is maintained as heterozygous. Homozygous Kras^LSL-G12D mice are embryonic lethal.

Development

The TET-GFPshKras462 targeting vector was designed with a short hairpin RNA (shRNA) targeting Kras (CTTGAAGATATTCACCATTA) fused to green fluorescent protein (GFP) cDNA, placed downstream of a tetracycline-responsive element (TRE) promoter, and targeted via recombinase-mediated cassette exchange (RMCE) into the ubiquitously expressed collagen, type I, alpha 1 (Col1a1) gene. shKras462 indicates that the position of the first base pair bound by the shRNA seed sequence is 462 in the KRAS transcript. The targeting vector also contained a hygromycin resistance cassette. The construct was electroporated into KH2-derived embryonic stem (ES) cells. Correctly targeted ES cells were injected into 8-cell embryos and resulting chimeric mice were bred with C57BL/6J mice to establish a colony.

This new strain, Stock No. 039144, was generated by crossing the resulting TET-GFPshKras462 offspring to Rosa26-CAGs-LSL-RIK knock-in mice (Stock No. 029633), to Kras^LSL-G12D mice (Stock No. 008179), and subsequently to p53^LoxP mice (Stock No. 008462) all on congenic C57BL/6 genetic backgrounds. Subsequently, mice were bred to C57BL/6NCrl mice for two least 2 generations by the donating laboratory (see SNP notes below). The donor sent males containing all four alleles to The Jackson Laboratory and, upon arrival, sperm was cryopreserved. To establish our live colony, an aliquot of frozen sperm was used to fertilize oocytes from B6.129-Kras^tm4Tyj Trp53^tm1Brn/J mice (Stock No. 032435).

In 2024, a 48 SNP (single nucleotide polymorphism) panel analysis, with 43 markers covering all 19 chromosomes and the X chromosome, as well as 5 markers that distinguish between the C57BL/6J and C57BL/6N substrains, was performed on the males sent to The Jackson Laboratory Repository. Five of the 43 markers throughout the genome were segregating with 129. Also, at least 3 of the 5 markers that determine C57BL/6J from C57BL/6N were found to be segregating. These data suggest the mice sent to The Jackson Laboratory Repository were on a mixed genetic background.

Allele

Symbol: Col1a1^{tm2(tetO-GFP/RNAi:Kras462)Ttam}
Name: targeted mutation 2, Tuomas Tammela
MGI accession ID: MGI:7610034
Generation method: Targeted
Attributes: Reporter; Inducible; RMCE-ready; Knockdown
Marker symbol: Col1a1
Marker name: collagen, type I, alpha 1
Marker synonyms: CAFYD; Col1a-1; Cola1; Cola-1; COLIA1; EDSARTH1; EDSC; Mov-13; OI1; OI2; OI3; OI4
Chromosome: 11
Strain of origin: (C57BL/6 x 129S4/SvJae)F1
Molecular note: The targeting vector was designed to insert a short hairpin RNA (shRNA) targeting Kras fused to green fluorescent protein (GFP) cDNA, placed downstream of a tetracycline-responsive element (TRE) promoter, and targeted via recombinase-mediated cassette exchange (RMCE) into the ubiquitously expressed collagen, type I, alpha 1 (Col1a1) gene. shKras462 indicates that the position of the first base pair bound by the shRNA seed sequence is 462 in the KRAS transcript. The targeting vector also contained a hygromycin resistance cassette.

Allele

Symbol: Trp53^tm1Brn
Name: targeted mutation 1, Anton Berns
MGI accession ID: MGI:1931011
Generation method: Targeted
Attributes: Conditional ready (e.g. floxed); No functional change
Synonyms: p53^Co; p53^f; p53^F2-10; p53^F2-10F; p53^fl; p53^flox; p53^L; p53^lox; p53^LoxP; p53Fl; Tp53^flox; Tp53^flx; Trp53^f; Trp53^F2-10; Trp53^F2-F10; Trp53^Fl; Trp53^lox; Trp53^loxP; Trp53-loxP flanked; Trp53^Flox
Marker symbol: Trp53
Marker name: transformation related protein 53
Marker synonyms: BCC7; BMFS5; LFS1; p44; p53; TRP53
Chromosome: 11
Strain of origin: 129P2/OlaHsd
Molecular note: Insertion of loxP sites flanking exons 2 through 10. No effect on the normal function of the gene.

Allele

Symbol: Gt(ROSA)26Sor^{tm2(CAG-rtTA3,-mKate2)Slowe}
Name: targeted mutation 2, Scott Lowe
MGI accession ID: MGI:5638918
Generation method: Targeted
Attributes: Conditional ready (e.g. floxed); Reporter; Transactivator
Synonyms: R26Sor^{tm2(CAGs-LSL-RIK)Slo}
Marker symbol: Gt(ROSA)26Sor
Marker name: gene trap ROSA 26, Philippe Soriano
Marker synonyms: beta geo; Gtrgeo26; Gtrosa26; R26; ROSA26; SETD5-AS1; Thumpd3as1
Chromosome: 6
Strain of origin: (C57BL/6J x 129S4/SvJae)F1
Expressed genes: rtTA,reverse tetracycline-controlled transactivator,E. coli
Site of expression: When these mutant mice are bred to mice that express Cre recombinase, the resulting offspring will express rtTA3 in cre-expressing tissues with subsequent expression of RFP (mKate2) under control of a tetracycline-responsive promoter element (TRE; or tetO) that can be induced/regulated by tetracycline or its analog doxycycline (dox).
Molecular note: The targeting construct introduced into the locus a CAG promoter, floxed stop cassette, reverse tetracycline transactivator 3 (rtTA3), IRES and a far red reporter gene (mKate2).
General note: ES cell line = C10, not C2 (Jaenisch) as reported by original reference. C10 ES cells carry Col1a1.

Allele

Symbol: Kras^tm4Tyj
Name: targeted mutation 4, Tyler Jacks
MGI accession ID: MGI:2429948
Generation method: Targeted
Attributes: Conditional ready (e.g. floxed); Null/Knockout
Synonyms: caKRas; KR; K-Ras(G12D)^fl; Kras^G12D; K-Ras^L; Kras^Lox; K-ras^LSL; Kras^LSL-G12D; Kras2^tm4Tyj; Kras2tm14Tyj; K-RasG12D; Lox-Stop-Lox-Kras^G12D; LSL-Kras G12D; LSL-K-ras G12D; LSL-Kras^G12D; LSL-K-ras^G12D; LSL-KrasG12D
Marker symbol: Kras
Marker name: Kirsten rat sarcoma viral oncogene homolog
Marker synonyms: CFC2; c-Ki-ras; c-Ki-ras2; 'C-K-RAS; C-K-RAS; Ki-ras; K-ras; K-Ras 2; KRAS1; KRAS2; Kras-2; K-RAS2A; K-RAS2B; K-RAS4A; K-RAS4B; NS; NS3; OES; p21; RALD; RALD2; RASK2
Chromosome: 6
Strain of origin: 129S4/SvJae
Site of expression: Cre-inducible expression of oncogenic Kras^G12D protein
Molecular note: Glycine codon 12 was changed to aspartic acid (p.G12D) to encode an oncogenic form of the KRAS2 protein. A loxP site flanked STOP cassette was included upstream of the inserted Kras2 sequence, such that the mutant transcript would be expressed only after Cre-mediated recombination.