Stock No: 008863
Protocol 41828: Standard PCR Assay - Tg(Tek-cre)1Ywa-Chr5-STD
Version 2.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 161 bp
Heterozygote = 161 bp and 220 bp
Wild type = 220 bp

>chr5:36382107-36382326 220bp CTGTGACCTGAGTGCCCAGT CCACACACGTGCACATATAGA

The Common R primer (primer 58517) anneals over the nucleotide sequence containing mouse genomic variations rs584328794 and rs578630781.

This assay may be capable of distinguishing hemi from hom.  Transgene insertion site is known to be on mouse Chr 5.

This assay is designed around this insertion site, but it has not been tested on hom animals.

This assay is NOT able to be used for copy number evaluation.  If this is required, it is suggested to type by qPCR.

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
58516 CTG TGA CCT GAG TGC CCA GT Wild type Forward A mChr5
58517 CCA CAC ACG TGC ACA TAT AGA Common A mChr5
58522 GCG TTT AAG TAA TGG GAT GGT C Mutant Forward A Tek

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
58516 0.50 uM
58517 0.50 uM
58522 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.