Protocol 36105: Separated PCR Assay - Myf5<tm4.1(Myod1)Sor>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr10:107485622-107485877 256bp TCCTGTATCCCCTCACCAGA CGAAAGCTTGGTTGACCTTC

Mutant = 162 bp
Heterozygote = 162 bp and 256 bp
Wild type = 256 bp

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
47849 CTC TGA TGG CAT GAT GGA TT Mutant Forward B Myod1 Exons 1-2
47850 GAG ATG CGC TCC ACT ATG CT Mutant Reverse B Myod1 cDNA exon 3
47851 TCC TGT ATC CCC TCA CCA GA Wild type Forward A
47852 CGA AAG CTT GGT TGA CCT TC Wild type Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
47851 0.50 uM
47852 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Reaction B

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
47849 0.50 uM
47850 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -1.0 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles
6 94.0 --
7 55.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.

Strains Using This Protocol

This is the only strain that uses this protocol.