For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 129 bp
Wild Type = 199 bp
>chr6:113026006-113026204 199bp AAGGGAGCTGCAGTGGAGTA AGAAGACTCCCGCCCATCT
Sequence
Wt Sequence: gggctgttttggaggcaggaagcacttgctctcccaaagtcgctctgagttgttatcagtaagggagctgcagtggagtaggcggggagaaggccgcacccttctccggaggggggaggggagtgttgcaatacctttctgggagttctctgctgcctcctggcttctgaggaccgccctgggcctgggagaatcccttccccctcttccctcgtgatctgcaactccagtctTTCTagaagatgggcgggagtcttctgggcaggcttaaaggctaacctggtgtgtgggcgttgtcctgcaggggaattgaacaggtgtaaaattggagggacaagacttcccacagattttcggttttgtcgg
Mutant Sequence:TGAATTAATTCCGGTATAACTTCGTATAATGTATGCTATACGAAGTTATCTCGAATCGCGCGCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCTCGAAGCTTTTAATTaactAGAAGATGGGCGGGAGTCTTCTGGGCAGGCTTAAAGGCTAACCTGGTGTGTGGGCGTTGTCCTGCAGGGGAATTGAAC
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 39823 | Fluorophore-1 | TCC GGT ATA ACT TCG TAT AAT GTA TG | Quencher-1 | Mutant Forward | A | |
| 39824 | Fluorophore-2 | AGA AGA CTC CCG CCC ATC T | Quencher-2 | Common | A | |
| 39825 | Fluorophore-3 | ATC TCG AAT CGC GCG CG | Quencher-3 | MUT Probe | ||
| 39826 | Fluorophore-4 | CTG GGC CTG GGA GAA TCC C | Quencher-4 | WT Probe | ||
| oIMR9020 | AAG GGA GCT GCA GTG GAG TA | Wild type Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 39823 | 0.40 uM |
| 39824 | 0.40 uM |
| oIMR9020 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.