For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 214 bp
Heterozygote = 214 bp and 241 bp
Wild type = 241 bp
>chr6:113025964+113026204 241bp CAGGACAACGCCCACACA AAGGGAGCTGCAGTGGAGTA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 24500 | CAG GAC AAC GCC CAC ACA | Wild type Reverse | A | |||
| 38651 | TCC CCA TCA AGC TGA TCC | Mutant Forward | A | STOP cassette | ||
| 38652 | CTT CTT CTT TGG GGC CAT CT | Mutant Reverse | A | Cas9 | ||
| oIMR9020 | AAG GGA GCT GCA GTG GAG TA | Wild type Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 24500 | 0.50 uM |
| 38651 | 0.50 uM |
| 38652 | 0.50 uM |
| oIMR9020 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 026175 | B6J.129(B6N)-Gt(ROSA)26Sortm1(CAG-cas9*,-EGFP)Fezh/J |
| 026556 | B6N.129(B6J)-Gt(ROSA)26Sortm1(CAG-cas9*,-EGFP)Fezh/J |
| 026481 | FVB.129(B6)-Gt(ROSA)26Sortm1(CAG-cas9*,-EGFP)Fezh/J |
| 026431 | NOD.129(B6)-Gt(ROSA)26Sortm1(CAG-cas9*,-EGFP)Fezh/J |
| 027891 | NOD/ShiLtJ-Gt(ROSA)26Sorem1(CAG-cas9*,-EGFP)Dvs/DvsJ |
| 5 strains use this protocol | |