For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:37729973-37730094 122bp AAGACCGCACTGGACAAAAC GAGTTGGGTGAGCTTGCAG
Mutant= 171 bp
Wild Type = 122 bp
Sequence
Wt Sequence: AAGACCGCACTGGACAAAACACTGAGGAGAAAAGTCTTTTGATGTaaatgctgatctttcttcatgtaaaagtaagtggttatgcacacctgtatgataacctctGCAAGCTCACCCAactc
Mutant Sequence: ATCACTCTCGGCATGGACGAGCTGTACAAGTAAAGCGGCCGCGACTCTAGAATAACTTCGTATAATGTATGCTATACGAAGTTATTTAATTAAaaatgctgatctttcttcatgtaaaagtaagtggttatgcacacctgtatgataacctctgcaagctcacccaactc
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 26816 | GAT CAC TCT CGG CAT GGA C | Transgene Forward | A | |||
| 36925 | AAG ACC GCA CTG GAC AAA AC | Wild type Forward | A | |||
| 36926 | GAG TTG GGT GAG CTT GCA G | Common | A | |||
| 36927 | Fluorophore-1 | CTG TAC AAG TAA AGC GGC CG | Quencher-1 | MUT Probe | ||
| 36928 | Fluorophore-2 | CTG AGG AGA AAA GTC TTT TGA TGT AAA | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 26816 | 0.40 uM |
| 36925 | 0.40 uM |
| 36926 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.