Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
Mutant= 175 bp
Wild Type = 178 bp
This assay is capable of distinguishing hemi from hom.
Wt Sequence:
ccagggcaaaacctcaaaactctgtactggacatttctcaaggccaggtcaatgcaaacatcacatgcacacggtttggaagtgctgccctacaagggctCTGActcaacccattttagacataatagttgactttgaccttcaaattgacagg
tcctatgtgaaacataaagattttggaatttcagaagattaacaaacgtagcatacagaacaaaatatggtgcacgatcagcatcaccctgttctgagtcaagatttttg
Mutant Sequence: ATCAAAGAAGTAAGCTCCACCTTAGAAAAAAGTGGAACGTCATGCTAaggACTCAACCCATTTTAGACATAATAGTTGACTTTGACCTTCAAATTGACAGGTCC
TATGTGAAACATAAAGATTTTGGAATTTCAGAAGATTAACAAACGTAGCATACAGAACAAAATATGGTGCACGATCAGCATCACCCTGTTCTGAGTCAAGATTTTTGTTTTGTTTTGTT
TTGTTTTgttttgttttgttttgttttgttttgttttatatccatggctggcaggcatattag
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 20239 | TGC AAA CAT CAC ATG CAC AC | Wild type Forward | A | |||
| 28843 | CGT GCA CCA TAT TTT GTT CTG T | Common | A | |||
| 28844 | CAA AGA AGT AAG CTC CAC CTT AGA | Mutant Forward | A | |||
| 28845 | Fluorophore-1 | CCT ACA AGG GCT CTG ACT CAA CC | Quencher-1 | WT Probe | ||
| 28846 | Fluorophore-2 | AAA GTG GAA CGT CAT GCT AAG GA | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 20239 | 0.40 uM |
| 28843 | 0.40 uM |
| 28844 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.