For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination. The transgene genotype is determined by comparing ΔCt values of each unknown sample against known homozygous and hemizygous controls, using appropriate endogenous references.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:122920940-122921054 115bp CCTCAAAAATGACACAGCTTGA TCAGTGAGACAAACAGAACTGC
Mut= 140 bp
Wt= 115 bp
Sequence
Wt Sequence:
ccagttagggagaaagacttcaccagttctcatcctgggtcacagaaactgaatgctcacaagtgcacagcatgtgtgaatgagaagccaagctgtccagttttgttttcttacctcaaaaatgacacagcttgaacctgggctttgcgtttgtttcctttgataattaactgctactttaaagttcagcattgcttataagacaagcagttctgtttgtctcactgatttattttattttgttaatataatttatttgatctagtgataatcataagctattcaacaattaggttttcttctttcccttttctttt
Mutant Sequence:
cccagttagggagaaagacttcaccagttctcatcctgggtcacagaaactgaatgctcacaagtgcacagcatgtgtgaatgagaagccaagctgtccagttttgttttcttacctcaaaaatgacacagcttgaacctATAACTTCGTATAATGTATGCTATACGAAGTTATgggctttgcgtttgtttcctttgataattaactgctactttaaagttcagcattgcttataagacaagcagttctgtttgtctcactgatttattttattttgttaatataatttatttgatctagtgataatcataagctattcaacaattaggttttcttctttcccttttctttttctttttctttttggagtggct
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 34626 | CCT CAA AAA TGA CAC AGC TTG A | Forward | A | |||
| 34627 | TCA GTG AGA CAA ACA GAA CTG C | Reverse | A | |||
| 34719 | Fluorophore-1 | AAC CTG GGC TTT GCG TTT | Quencher-1 | WT Probe | ||
| 68294 | Fluorophore-2 | CGT ATA G+C +A+ T+A +C+ ATT ATA CG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTPS-kapa | 0.26 mM |
| 34626 | 0.50 uM |
| 34627 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.