For in-depth product & services help, ask our
Technical Information Scientists
Notes
This assay will NOT distinguish hemizygous from homozygous transgenic animals.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Transgene = 308 bp
Internal positive control = 404 bp
chr14:54383804+54384207 404bp CTTTGCCTGCCAGCCT TGAGGGAACCACGGTATTGAG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73552 | CAC TAA GGG AGC CAA TGT AGA C | Mutant Forward | A | Villin | ||
| 73553 | GAA CCC GAA CAC GCC AAC | Mutant Reverse | A | Snhg9 | ||
| 73554 | CTT TGC CTG CCA GCC T | Internal Positive Control Forward | A | Trdc | ||
| 73555 | TGA GGG AAC CAC GGT ATT GAG | Internal Positive Control Reverse | A | Trdc |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 73552 | 0.50 uM |
| 73553 | 0.50 uM |
| 73554 | 0.50 uM |
| 73555 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.