Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
>chr16:38415643-38415752 110bp TGGCTGGAATCTGCTATGTG CCAGATGTGGAACCAGCAC
Mutant= 83 bp
Wild Type = 110 bp
Wt Sequence: tggctggaatctgctatgtgttgtgagttgtacatgcaAcgagaggccctttcagataatttacatgtgcggatgctggaaagctccacgtgtgctggttccacatctgg
Mut Sequence: tggctggaatctgctatgtgttgtgagttgtacatgcaAGtcacaagacatggtattgcacaaaaataaggaatgctgactgt
A 544 bp deletion beginning at Chromosome 16 position 38,415,170 bp and ending after 38,415,713 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65536 | TGG CTG GAA TCT GCT ATG TG | Common | A | |||
| 65537 | ACA GTC AGC ATT CCT TAT TTT TGT G | Mutant Reverse | A | |||
| 65538 | CCA GAT GTG GAA CCA GCA C | Wild type Reverse | A | |||
| 65539 | Fluorophore-1 | TAC ATG CAA GTC ACA AGA CAT GGT | Quencher-1 | MUT Probe | ||
| 65540 | Fluorophore-2 | AGG CCC TTT CAG ATA ATT TAC ATG T | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65536 | 0.40 uM |
| 65537 | 0.40 uM |
| 65538 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.