Protocol 44030: Standard PCR Assay - Igs7<tm1(tetO-jGCaMP8m,CAG-tTA2)Genie>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr9:21545218+21545512 295bp GTGTAGCCCTGGCTTTTCTG GAAGAGTAAAAACGCACTCTGC

Mutant = 197 bp
Heterozygote = 197 bp and 295 bp
Wild type = 295 bp

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
22159 GTG TAG CCC TGG CTT TTC TG Wild type Forward A
34011 GAA GAG TAA AAA CGC ACT CTG C Wild type Reverse A
64610 TCT CAG TAT TGT TTT GCC AAG TTC Mutant Forward A
64611 GCG GCC GAT GAT CTT CAC Mutant Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
22159 0.50 uM
34011 0.50 uM
64610 0.50 uM
64611 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.