Protocol 43853: Standard PCR Assay - Gt(ROSA)26Sor<tm1(birA)Srgj>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr6:113075769-113076067 299bp CTCTTCCCTCGTGATCTGCAACTCC CATGTCTTTAATCTACCTCGATGG

Mutant = 181 bp
Heterozygote = 181 bp and 299 bp
Wild type = 299 bp

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
64130 ATC CCG CTG CTG AAC GCT AAA C Mutant Forward A
64131 ACC ATT TCC TCC CTC TGC TTC C Mutant Reverse A
64132 CTC TTC CCT CGT GAT CTG CAA CTC C Wild type Forward A
64133 CAT GTC TTT AAT CTA CCT CGA TGG Wild type Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
64130 0.50 uM
64131 0.50 uM
64132 0.50 uM
64133 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.