Protocol 42039: Separated PCR Assay - Isr(HSA17)-H1
Version 3.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr11:104265226+104265523 298bp TTCTTAACCGCTGAGCCATC CCTTTGGGATTTTAACCATGTG

Mutant =  620 bp (Strains 35794, 36664, and 35398 H1) 
Heterozygote =  620 bp (Strains 35794, 36664, and 35398 H1)  and 298 bp
Wild type = 298 bp

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
49773 TTC TTA ACC GCT GAG CCA TC Wild type Forward A
49774 CCT TTG GGA TTT TAA CCA TGT G Wild type Reverse A
57519 CGG CAC ATT CCC AGA GAA CT Mutant Forward B
57520 CCT AGA GGA AAG GTC ACC G Mutant Reverse B

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
49773 0.50 uM
49774 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Reaction B

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
57519 0.50 uM
57520 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
036664 B6(Cg)-Isr(HSA17;rs63751011-T)3Mdk/J
037778 B6(SJL)-Apoetm1.1(APOE*4)Adiuj Isr(HSA17)2Mdk Appem1Adiuj/J
035794 B6J.B6N(Cg)-Isr(HSA17;MAPT*N279K)4Mdk/J
035398 B6J.B6N-Isr(HSA17)2Mdk/J
037420 B6J.B6N-Isr(HSA17;MAPT*P301L)5Mdk/J
040815 B6J.Cg-Isr(HSA17;MAPT*R406W)2Adiuj/J
040796 B6J.Cg-Isr(HSA17;MAPT*S320F)1Adiuj/J
7 strains use this protocol