For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 83 bp
Wild Type = 88 bp
chr16:84963001-84963088 88bp GCTTCAGATCCCTGCAGACT TGGAACAATGAGCAACAGGT
Sequence
Wt Sequence: cacctgctgtgggcaggaacggagtgacctgtttccagaacaatggcggggacctctatttggtttttaccaaatgcttacctgttaaagggcttcagATCCCTGCAGACTTCTAcctcatgatgcaccagagaaattgACTTCAGAACCCGGGAAGCCACCTGTtgctcattgttccagagacgaggacgctcagtcctagggacccaccaactcacgcttcgctgagctatggcggagggtcccctgaaactttgctacat
Mutant Sequence: tcgaaacccttttggtcatgaccattctcggtccacgatagttttatttgaagaattggtcttaaataagcatgtggggagtacttggttgtagggatgctctctcgcagtgcttggttaGATCATAAGAAGTTCCTATACTTACTAGAGAATAGGAACTTCGGAATAGGAACTTCGGCGCGCCACTAGTttaagttctcatctacaaatggataatttcagtccattccaacccctcctccttcctactgcttccccacctcccagtatttctttggcttacaagggaaagttagcagagaccctttaaggtgagtgaagcccagcggtgactttgccgcctcagcttctcagtcagaaatcttgggcaaggcagatagca... ...tatttggtttttaccaaatgcttacctgttaaagggcttcagatccctgcagacttctacctcatgatgcacACGCGCCGAAGTTCCTATACTATTTGAAGAATAGGAACTTCACTAGTcagagaaattgacttcagaacccgggaagccacctgttgctcattgttccagagacgaggacgctcagtcctagggacccaccaactcacgcttcgctgagctatgg
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 14256 | AAC TTC GGA ATA GGA ACT TCG | Mutant Forward | A | |||
| 50360 | GCT TCA GAT CCC TGC AGA CT | Wild type Forward | A | |||
| 50361 | TGG AAC AAT GAG CAA CAG GT | Wild type Reverse | A | |||
| 50362 | GGA GGG GTT GGA ATG GAC | Mutant Reverse | A | |||
| 50363 | Fluorophore-1 | CGC GCC ACT AGT TTA AGT TCT CAT C | Quencher-1 | MUT Probe | ||
| 50364 | Fluorophore-2 | CCT CAT GAT GCA CCA GAG AAA TTG | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 14256 | 0.40 uM |
| 50360 | 0.40 uM |
| 50361 | 0.40 uM |
| 50362 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.