Protocol 36785: Standard PCR Assay - E2f1<Tg(Wnt1-cre)2Sor> Alternate1
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 185 bp
Heterozygote = 185 bp and 282 bp
Wild type = 282 bp

>chr2:154561403-154561684 282bp CAAAATCCATTTCCCAGTCC CCATCTGTTCTGCAGGGTCT 

This assay is be capable of distinguishing hemi from hom.  Transgene insertion site is known to be on mouse Chr 2.

This assay is NOT able to be used for copy number evaluation.  If this is required, it is suggested to type by qPCR.

 

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
48514 TGC AAC GAG TGA TGA GGT TC Transgene Forward A Tg F (Cre)
48516 GAG GTC TAT CCA GGC ATT GG Mutant Reverse A Mut R (E2f1)
49698 CAA AAT CCA TTT CCC AGT CC Wild type Forward A Wt F
49699 CCA TCT GTT CTG CAG GGT CT Wild type Reverse A Wt R

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
48514 0.50 uM
48516 0.50 uM
49698 0.50 uM
49699 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.