For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = ~ 200 bp
Heterozygote = ~ 200 bp and 300 bp
Wild type = 300 bp
>chr9:53479541-53479840 300bp TGATCTGTCAGGGGAATGAAC GCTGAGATGCTAACGGTATAAACA
Sequence
Wt Sequence: AGATACACATGAATCGTGGAGAACTCTGCTGTCTGcGCACGTCCGAGGATTTTTCACTAGTTGTTTTAAGCATTCCTCCCAAGCA
Mutant Sequence: gactgccttgggaaaagcgcctcccctacccggtagaattgacctgcaggggccctcgaGCACGTCCGAGGATTTTTCACTAGTTGTTTTAAGCATTCCTCCCAAGCA
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 48120 | TGA TCT GTC AGG GGA ATG AAC | Wild type Forward | A | |||
| 48121 | GCT GAG ATG CTA ACG GTA TAA ACA | Common | A | |||
| oIMR2088 | AGA CTG CCT TGG GAA AAG CG | Mutant Forward | A | PGK |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 48120 | 0.50 uM |
| 48121 | 0.50 uM |
| oIMR2088 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.