Stock No: 032823
Protocol 34979: Standard PCR Assay - Gpr108<tm1.1Brs>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr17:57246758-57246912 155bp TGTGCCACTGTGTCTTTGGT CCTCACCTTTGGCAACTTCT

Mutant = 362 bp
Heterozygote = 362 bp and 155 bp
Wild type = 155 bp

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
44956 TGT GCC ACT GTG TCT TTG GT Wild type Forward A
44958 CCT CAC CTT TGG CAA CTT CT Wild type Reverse A
44959 ATT GTA CCA CAA GAG GCT GAA CTG Mutant Forward A
44960 ACT ATT GGC TGA AAA GTG GGT AGG Mutant Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
44956 0.50 uM
44958 0.50 uM
44959 0.50 uM
44960 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.