For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 116 bp
Heterozygote = 116 bp and 148 bp
Wild type = 148 bp
This assay is capable of distinguishing hemi from hom. Integration site is known to be on mChr2.
>chr2:100921800-100921947 148bp AGCACTAGACTTCTTGTCAGAAACT TTTCTGTCAGTTAGCTTTATGCTTT
Sequence
Wt Sequence:
agcactagacttcttgtcagaaactatggaagcaagaggagggtagataaactggtttcaagttttagaaGGAAACATATTCCAAagtacagcatttgtattttactttaaaatttaaatcttaaagcataaagctaactgacagaaa
Mutant Sequence:
CTCCTGACCTCATGATCCACCCGCCTCTGCCTCCCAAAGGGgtgggattccaAAGTACAGCATTTGTATTTTACTTTAAAATTTAAATCTTAAAGCATAAAGCTAACTGACAGAAATG
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 37999 | CTC CTG ACC TCA TGA TCC AC | Transgene Forward | A | FCGRT | ||
| 38003 | Fluorophore-1 | TCT GCC TCC CAA AGG GGT | Quencher-1 | Tg Probe | FCGRT | |
| 43800 | AGC ACT AGA CTT CTT GTC AGA AAC T | Wild type Forward | A | mChr2 | ||
| 43801 | TTT CTG TCA GTT AGC TTT ATG CTT T | Common | A | mChr2 | ||
| 43802 | Fluorophore-2 | TGG AAG CAA GAG GAG GGT AGA | Quencher-2 | WT Probe | mChr2 |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 37999 | 0.40 uM |
| 43800 | 0.40 uM |
| 43801 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
| Stock Number | Strain Name |
|---|---|
| 018441 | B6.Cg-Fcgrttm1Dcr Prkdcscid Tg(FCGRT)32Dcr/DcrJ |
| 037524 | B6.Cg-Tg(ALB)9463J Tg(FCGRT)32Dcr Albem12Mvw Fcgrttm1Dcr/J |
| 031644 | B6.Cg-Tg(FCGRT)32Dcr Albem12Mvw Fcgrttm1Dcr Prkdcscid /J |
| 025201 | B6.Cg-Tg(FCGRT)32Dcr Albem12Mvw Fcgrttm1Dcr/MvwJ |
| 035448 | B6.Cg-Tg(FCGRT)32Dcr Fcgrttm1Dcr Ace2em4Lutzy/J |
| 029686 | B6.Cg-Tg(FCGRT)32Dcr Fcgrttm1Dcr Ighg1em2(IGHG1)Mvw/MvwJ |
| 037043 | B6.Cg-Tg(K18-ACE2)2Prlmn Tg(FCGRT)32Dcr Fcgrttm1Dcr/2J |
| 034902 | B6.Cg-Tg(K18-ACE2)2Prlmn Tg(FCGRT)32Dcr Fcgrttm1Dcr/J |
| 028615 | NOD.Cg-Fcgrttm1Dcr Prkdcscid Il2rgtm1Wjl Tg(FCGRT)32Dcr/J |
| 9 strains use this protocol | |