Protocol 32973: Separated PCR Assay - Gt(ROSA)26Sor<tm1(CAG-EYFP*,-mEYFP*,-tdTomato*,-mTFP1*)Ben>
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

>chr6:113075914-113076210 297bp AAGGGAGCTGCAGTGGAGTA CCGAAAATCTGTGGGAAGTC

Mutant = 332 bp
Heterozygote = 332 bp and 297 bp
Wild type = 297 bp

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
40380 AGG TGA CCG TTT ACG AGA GC Mutant Forward B
40381 AAT GAA AGC CAT ACG GGA AG Mutant Reverse B
oIMR9020 AAG GGA GCT GCA GTG GAG TA Wild type Forward A
oIMR9021 CCG AAA ATC TGT GGG AAG TC Wild type Reverse A

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
oIMR9020 0.50 uM
oIMR9021 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Reaction B

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTPS-kapa 0.26 mM
40380 0.50 uM
40381 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

Stock Number Strain Name
031298 STOCK Gt(ROSA)26Sortm1(CAG-EYFP*,-mEYFP*,-tdTomato*,-mTFP1*)Ben/Gt(ROSA)26Sortm2(CAG-EYFP*,-mCherry*,-EGFP*,-mCerulean*)Ben/J
031301 STOCK Gt(ROSA)26Sortm1(CAG-EYFP*,-mEYFP*,-tdTomato*,-mTFP1*)Ben/J
2 strains use this protocol