For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 96 bp
Wild Type = 110 bp
>chr9:33514651+33514760 110bp TGGGATATGTTGTACAAAAAGAACT TTAGCTAGCTGAACTCTAAATGAGC
This assay is capable of distinguishing hemi from hom.
This assay is NOT to be used for copy number evaluation. If this is required, it is suggested to type by qPCR.
This protocol can be used for conventional PCR. Omit probes and run as a separated assay.
Sequence
Wt Sequence:
aggtcactaggaagctttattaagatttttgtcctcacattagtttgattgcagattggtggcacattgaataaaaacagtcacattttgagcttgatggatgggatatgttgtacaaaaagaactccatctaacaaatgTActtatgcaaatcagcatgctagaattccagtacatttttttttagctcatttagagttcagctagctaagttgacagctggctcagtattattcttcttcttttaatgttctcactattaattgtgtgtgtgtgtgt
Mutant Sequence:
GAAGGCAACTCTAAGGTCACTAGGAAGCTTTATTAAGATTTTTGTCCTCACATTAGTTTGATTGCAGATTGGTGGCACATTGAATAAAAACAGTCACATTTTGAGCTTGATGGATGGGATATGTTGTACAAAAAGAACTCCATCTAACAAATGTgacctgcaggtcaacgGATCGTGGGATTGGGTCCCTGGGGAAAGGTGTTGCCCGTGGGGTCAGACTGAGCCATAAGCGGCTGTAGCCTTTGGAATGACATACTTCCAAGTTCT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 40203 | TGG GAT ATG TTG TAC AAA AAG AAC T | Common | A | mChr9 | ||
| 40204 | TTA GCT AGC TGA ACT CTA AAT GAG C | Wild type Reverse | A | mChr9 | ||
| 40205 | Fluorophore-1 | ATC AGC ATG CTA GAA TTC CAG TAC ATT | Quencher-1 | WT Probe | ||
| 40206 | CAC GGG CAA CAC CTT TCC | Mutant Reverse | A | rat | ||
| 40207 | Fluorophore-2 | ATG TGA CCT GCA GGT CAA CG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 40203 | 0.40 uM |
| 40204 | 0.40 uM |
| 40206 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.