Protocol 32790: Standard PCR Assay - Gt(ROSA)26Sor<tm1(CAG-COX8A/Dendra2)Dcc> Alternate1
Version 1.0

Notes

The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX). To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility. Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.

Expected Results

Mutant = 203 bp
Heterozygote = 203 bp and 361 bp
Wild type = 361 bp

>chr6:113025699-113026059 361bp CTTCCCTCGTGATCTGCAAC CGCGACACTGTAATTTCATACTG

JAX Protocol

Protocol Primers

Primer 5' Label Sequence 5' → 3' 3' Label Primer Type Reaction Note
28955 CGC GAC ACT GTA ATT TCA TAC TG Wild type Reverse A
36158 CTT CCC TCG TGA TCT GCA AC Wild type Forward A
39999 GGA CAT CCC CGA CTA CTT CA Mutant Forward A Dendra2
40001 GCT CCC ACT TCA GGG TCT TC Mutant Reverse A Dendra2

Reaction A

Component Final Concentration
ddH2O
Kapa 2G HS buffer 1.30 X
MgCl2 2.60 mM
dNTP KAPA 0.26 mM
28955 0.50 uM
36158 0.50 uM
39999 0.50 uM
40001 0.50 uM
Glycerol 6.50 %
Dye 1.00 X
Kapa 2G HS taq polym 0.03 U/ul
DNA

Cycling

Step Temp °C Time Note
1 94.0 --
2 94.0 --
3 65.0 -- -0.5 C per cycle decrease
4 68.0 --
5 -- repeat steps 2-4 for 10 cycles (Touchdown)
6 94.0 --
7 60.0 --
8 72.0 --
9 -- repeat steps 6-8 for 28 cycles
10 72.0 --
11 10.0 -- hold
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.

Strains Using This Protocol

This is the only strain that uses this protocol.