For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:62480465-62480710 246bp CATGGCATTGGAGCCATAAG CTGGGGTTCTCCTCTGTGTC
Heterozygote/Homozygote = 246 bp and 475 bp
Wild type = 246 bp
This assay cannot distinguish between heterozygote and homozygote. iCre QPCR can be used to type for zygosity.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 36289 | CAT GGC ATT GGA GCC ATA AG | Common | A | |||
| 36290 | CTG GGG TTC TCC TCT GTG TC | Wild type Reverse | A | |||
| 36291 | TGT TGG ATG GTC TTC ACA GCC | Mutant Reverse | A | iCre |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 36289 | 0.50 uM |
| 36290 | 0.50 uM |
| 36291 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.