For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 171 bp
Heterozygote = 109 bp and 171 bp
Wild type = 109 bp
Sequence
Mutant Sequence:
GATCCTGTAGCACTTAGATGGGGCAGGTGCTCTATCTACCACGGGGCTCTCTCTCTGTCGACGGTATCGATAAGCTTGATATCGAATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCATCAGTCAGGTACATAATATAACTTCGTATAGCATACATTATACGAAGTTATTAGGTGGATCCACTAGTTCTAGAGCGGCCGCACGCGTACTAGTACCCCCATGTGGAAAATCTGAGTCCTAGAACATGAGAAGGAGTACAAGTATTCTTCCAT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 24298 | ACT TCC CTA CCC ACC CAT TC | Wild type Reverse | A | |||
| 24759 | ATC TAC CAC GGG GCT CTC TC | Mutant Forward | A | |||
| 24761 | GCC GCT CTA GAA CTA GTG GA | Mutant Reverse | A | |||
| 24963 | ACT TAG ATG GGG CAG GTG CT | Wild type Forward | A |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| Primer 1 | 0.50 uM |
| Primer 2 | 0.50 uM |
| Primer 3 | 0.50 uM |
| Primer 4 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 94.0 | -- | |
| 2 | 94.0 | -- | |
| 3 | 65.0 | -- | -0.5 C per cycle decrease |
| 4 | 68.0 | -- | |
| 5 | -- | repeat steps 2-4 for 10 cycles (Touchdown) | |
| 6 | 94.0 | -- | |
| 7 | 60.0 | -- | |
| 8 | 72.0 | -- | |
| 9 | -- | repeat steps 6-8 for 28 cycles | |
| 10 | 72.0 | -- | |
| 11 | 10.0 | -- | hold |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
JAX uses a 'touchdown' cycling protocol and therefore has not calculated the optimal annealing temperature for each set of primers.
Strains Using This Protocol
This is the only strain that uses this protocol.