For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant = 12 nucleotides absent
Wild type = 12 nucleotides present
Sequence
gaggactgactgttctgttttgttccaatgccttggagcatcctgagtggctggatgctagag
cccatttaagggttccttcacccatcttggagcagcagggctcctgatggagactgttcttca
catcacctctgtttgtctagTTCATCCTGAACGTACGC[ttagactaccgc]ATCTCCTACCTGTTGT
CGGTCTTCAAGAAGGAGTTTGTGGAGGTGTTTCCCATGCAGGACAGCGGGGCGGACGGCACGG
CACCTGCCTTTGATTCCTCCAgtaagccttgacccctagcatctact
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 15847 | GGT TCC TTC ACC CAT CTT GG | Forward | A | |||
| 15848 | ACA CCT CCA CAA ACT CCT TC | Reverse | A | |||
| 15849 | Fluorophore-1 | GTA CGC TTA GAC TAC CGC ATC TCC | Quencher-1 | WT Probe | ||
| 15850 | Fluorophore-2 | TGA ACG TAC GCA TCT CCT ACC T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 15847 | 0.40 uM |
| 15848 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.