For in-depth product & services help, ask our
Technical Information Scientists
Notes
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
H2-T18<b> Variant = (Jr 457) = "hom"
H2-T18<b>= (Jrs 666, 664, 438) = "wt"
Please run JR 683 as well at validation
664 and 457 controls must be run 1-18-16 ESP
Sequence
(T/C)TG(GT/AC)GTTCTGATGAGTTATTGATCTAG(C/T)TATGATAATCAGTGATTG(ATTG/----)CTATT(A/G)T(A/C)CACAGTCACAAGCTCAAGATTATGAAT(T/C)TCCTA(C/T)G(C/G)GTTGTCTCTAAGTATA(TA/--)GACTTAAAAGGGCTTCTCATTGAGCT
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 25550 | Fluorophore-1 | AAT CAG TGA TTG ATT GCT ATT ATA AC | Quencher-1 | WT Probe | A | |
| 26436 | Fluorophore-2 | TCA GTG ATT GCT ATT GTC ACA GTC | Quencher-2 | MUT Probe | A | |
| 26747 | TGA CGT TCT GAT GAG TTA TTG ATC T | Forward | A | |||
| 26748 | AGC TCA ATG AGA AGC CCT TT | Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 25550 | 0.40 uM |
| 26436 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.