For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 91 bp
Wild Type = 102 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase:
tttgcagggtggggcaagaattcagaccatgacctcatgaaaaaagaaccacaacaccctttcccccagatttagggtatcagatctgagaaccgccttccataacacccaagtccacgtactacatagagctcgggatgggggtctgggatgccgctcagagggtggagtgctcatctaccattcaggaaaccagtaccacatATgctggtgagaatggagggtgtggtccaggccaggcagatctgtgaaggcacaggctctgggcttcctagcttaccatacagggccccacagagagtctttttcacctgttatgtctctgctctcctcggtctggacactagtcaggtcacacaacct
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: ACAAGCATATTCAGCTTATG and GTTTCAGTTTCTCCTGCTGC. This resulted in a 2,223 bp deletion of Chr8:3,495,024-3,497,246 (GRCm38/mm10) that removes exon ENSMUSE00001381064.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 79765 | CAG CTT AGA AGA TCT GGA CC | Wild type Forward | A | |||
| 79766 | AAA CTC GAA GAC ATG GGA TC | Wild type Reverse | A | |||
| 79767 | GGG TGG AGT GCT CAT CTA | Mutant Forward | A | |||
| 79768 | CTT CAC AGA TCT GCC TGG | Mutant Reverse | A | |||
| 79769 | Fluorophore-1 | AAG CTC CAC GAT CCA TCT T | Quencher-1 | WT Probe | ||
| 79770 | Fluorophore-2 | CCA GTA CCA CAT ATG CTG GTG A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 79765 | 0.40 uM |
| 79766 | 0.40 uM |
| 79767 | 0.40 uM |
| 79768 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.