For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 84 bp
Wild Type = 66 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
ctcctccctcactgtgtagtgagggctctggctggtgaatgctctgtctctgctttgaggcttccaggcttccctcccaccttcccataaactcctcccaccttcccactggctcctcccaccttcccactgactcctcccaccttcccatggactcctcccatactgcctcctcccttcagtcagaagctgaagctggttttatttacctttactgcactgtcctTGcgtgaaagcgttagaaagactgaaagcacaggggttctgatggtaggtgctagtgcaggctccccgaggtccacctcaggcagaaggaacagccaattgctgctctgtcttgtttcctctgaccaggagcagccattcacttctcttgcgttgtggtcttcctgctgtggcacccaaacaccaac
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CCACTAGGCCTTCTCACACA and TAACGCTTTCACGCAATGCT. This resulted in a 7,317 bp deletion of Chr17:7,369,936-7,377,252 (GRCm38/mm10) that removes exons ENSMUSE00001032918 and/through ENSMUSE00001095086.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 77499 | TGA AGC TGG TTT TAT TTA CCT TT | Mutant Forward | A | |||
| 77501 | CTA CCA TCA GAA CCC CTG T | Mutant Reverse | A | |||
| 78357 | CAA TCT CGG GTG CTG ATC | Wild type Forward | A | |||
| 78358 | TAC ATG GGG CTT TGT TGG AT | Wild type Reverse | A | |||
| 79737 | Fluorophore-1 | AGC TAA GTC AGT GGC CAG | Quencher-1 | WT Probe | ||
| 79738 | Fluorophore-2 | ACT GTC CTT GCG TGA AAG C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 77499 | 0.40 uM |
| 77501 | 0.40 uM |
| 78357 | 0.40 uM |
| 78358 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.