For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman Probe/Endpoint protocols use a different analysis than qPCR. Please see your equipment manual for more information about Taqman endpoint analysis setup.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 108 bp
Wild Type = 120 bp
chr11:97756979-97757098 120bp TACTCCCTTGACCTTACACT CTAAACACATGAGGCACACT
Sequence
Large deletion: Mutant sequence with junction in uppercase
tgttaagcatgatgctgtgacatcatgtagagtcctccttttgtgttaaagcatcgtttactatcttactttcttttggttttcaagtgcaagctcatttactaaacaggtatctctgatcctttcccccttttctcaaacatgtagtcccactggggccactgtgccaagggccaggataggccgcgagctttcgcaaggaggtgtaatgtgtaagcttggtagaggagactaggtaactaagtaaagatccatgattctgaattttcctcAGcctgcctctgtgtatgtgtgtgtgtgcactgtgtgcctgtgtgtgtgtctgcactgtgtccatgcatggttcttgaagatgcagcaaaggggcatcagatcccctggaactacagatgttgtgaactgctatatggaaccctggtcctctggaagagcagcccgtgcttttaagtg
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCAGGCAGCCGTTCCCATGT and AATACTTCTCACAATCCATG. This resulted in a 1,923 bp. deletion of Chr11:97,756,111-97,758,033 (GRCm38/mm10) and removes exons ENSMUSE00000111149 and ENSMUSE00000111153.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 74700 | TAC TCC CTT GAC CTT ACA CT | Wild type Forward | A | |||
| 74701 | CTA AAC ACA TGA GGC ACA CT | Wild type Reverse | A | |||
| 74702 | TGT AAG CTT GGT AGA GGA GA | Mutant Forward | A | |||
| 74705 | CAC ACA CAG GCA CAC AGT | Mutant Reverse | A | |||
| 74706 | Fluorophore-1 | CAA ACA GGC TTC CTT CCT TC | Quencher-1 | WT Probe | ||
| 74708 | Fluorophore-2 | TTT CCT CAG CCT GCC TCT GT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 74700 | 0.40 uM |
| 74701 | 0.40 uM |
| 74702 | 0.40 uM |
| 74705 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.