For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 94 bp
Wild Type = 96 bp
>chr14:73514568+73514663 96bp ACATGTACTAGTTTCACAGAA ACCTAATACAGAGCCTTGATT
Sequence
Large deletion: Mutant sequence with junction in uppercase
tgttaaggataaatttaaaaattttatccttggaaggtgaacaaatctgaaatttggcatggtactactgctgaaagatttgttctttatggaagaggagcagaatgaatggcacttcttggtattaagactgtttcccaaaataaccacaaatggcatgctgattaagaatatttcaaggtgttaaaatgtataaacctagccaattcaattatagattatctcctggtGGggaggatgctcagtagttactcagtgtagcgtgtgatgtgttcttgcatcctgaagagggtacacgtagctcacaaccctccgttagtttataaccaatgagagaagcggatggggctttatctcaggtgtatagtgaggacactggtttacagaagtgttgagaaagaaggagaagcaaaattgaagttggatcttgaatgctaggaggaaacaatgttgggaaccacacagctaaactgagaaggaaacactagagtcagagacca
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GGATTATCAAGGCTACCACC and ACTCCAGTCGGGCTGTTGGG. This resulted in a 1,835 bp deletion of Chr14:73,513,756-73,515,590(GRCm38/mm10) that removes exons ENSMUSE00000123683 and ENSMUSE00000123680.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 74607 | ACA TGT ACT AGT TTC ACA GAA | Wild type Forward | A | |||
| 74608 | ACC TAA TAC AGA GCC TTG ATT | Wild type Reverse | A | |||
| 74609 | ACC TAG CCA ATT CAA TTA TAG A | Mutant Forward | A | |||
| 74610 | CTC TTC AGG ATG CAA GAA CA | Mutant Reverse | A | |||
| 74611 | Fluorophore-1 | TGC TCT TCC ATC TTA AGT TGG | Quencher-1 | WT Probe | ||
| 74612 | Fluorophore-2 | AGT TAC TCA GTG TAG CGT GTG A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 74607 | 0.40 uM |
| 74608 | 0.40 uM |
| 74609 | 0.40 uM |
| 74610 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.