For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman probe protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 97 bp
Wild Type = 123 bp
Sequence
Large deletion: Mutant sequence with junction in uppercase
aagtgacacctgttaaatacaagggtttatttttatgttttcttaactacaagttaaactggttgtgtcgcttgctcactagatagttttatactggtttgaagtacaacggtccctcctcctcctggactttgaccaaccaaacccagctgttacctaactcacacttacgtctttagtgagtgaagaactgtaagaaaaatagtcttttggtttttactaaaactgggtaggcacacatggtttgtttaaactttcaaaatgtctggcaatttttttatatttctacttttgttggtgacCTtagcacagaatatgaaaaaactcctctagtttaaaatgtacagcagatgcactatagtcaccttcaagctggttaaaagcttgacatgggaggtgaggagatcatttcttctagtacctgtatgtgtatgtcttatatatgtgtgtgtgacatacaggtgcgtataacatgttacatgtgtgcacgtgtatgtgtttgcatgtgtattatacattaccctaacctagcctaatccaaatggtttaacattttcctgtcagtgttcttgcctatagtgttttgggctgatacaaccaaatctgttctttcttatgtcactaagtccagtgtacaa
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TCATATTCTGTGCTAAGGGA and CTACTTTTGTTGGTGACCCC. This resulted in a 1,228 bp deletion of Chr3:10,334,329-10,335,556 (GRCm38/mm10) that removes exon ENSMUSE00000474119
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 74200 | CAC TTT GGC CAT TTT GAT GA | Wild type Forward | A | |||
| 74201 | TTT AAC ACA GGG ACG TGA AA | Wild type Reverse | A | |||
| 74202 | ACT TTC AAA ATG TCT GGC AA | Mutant Forward | A | |||
| 74203 | TGC TGT ACA TTT TAA ACT AGA GG | Mutant Reverse | A | |||
| 74205 | Fluorophore-1 | CAT GAT GCC TGT CAA CTC AT | Quencher-1 | WT Probe | ||
| 74206 | Fluorophore-2 | TGT TGG TGA CCT TAG CAC AGA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 74200 | 0.40 uM |
| 74201 | 0.40 uM |
| 74202 | 0.40 uM |
| 74203 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.