For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 75 bp
Wild Type = 113 bp
>chr19:10997266-10997378 113bp AAACAGTACCACCAGCATC GGCATTCTGTCAGCTATTCT
Sequence
Large deletion: Mutant sequence with junction in uppercase:
aaatttattgtttttaatagctgagtagtactccattgtataaatctaccatattttctgtatccattcctggaaacaaagactcttagcttacataataggcttgcattttagtgaagacaataacagaaataaggattaagagggactgttgggttttcggtggaaattgtatcttgtgtgttttgtagcagctgtgcatcatgagcaatcaagagaatgtgtctgctgtcaccgtccccaGAtagttgacagaatagctgacagaatgcccacttcaatgacatttcaaaggaagcgctgctacaacaatatctttgtttcaccttgaaacacctgtgactttgactttggcattacctctgggccaagatgaacatccattttttttccacctctttactcttaagcttccctttggtttgttattaattgtgcttttttttaattcataatcctttttccctttgactctagctatcttttaactttaacaaactgcatacaatgctgcattttgtgttttgttgcttattgggggaagccaattctaaactaatagacag
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GCATAACTTGGACATTACTG and GCTATTCTGTCAACTATTTC. This resulted in a 16,393 bp deletion of Chr19:10,997,295-11,013,687 (GRCm38/mm10) that removes exons ENSMUSE00001053564 through ENSMUSE00001006950
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73802 | AAA CAG TAC CAC CAG CAT C | Wild type Forward | A | |||
| 73803 | GGC ATT CTG TCA GCT ATT CT | Common | A | |||
| 73804 | Fluorophore-1 | TAC CAA GAT GTA GCC CAG AA | Quencher-1 | WT Probe | ||
| 73805 | GCA TCA TGA GCA ATC AAG AG | Mutant Forward | A | |||
| 73806 | Fluorophore-2 | ATG TGT CTG CTG TCA CCG TC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 73802 | 0.40 uM |
| 73803 | 0.40 uM |
| 73805 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.