For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Sequence
Wt Sequence (deletion in UPPER case):
ggagtcggggacggaacaaagcacggcctgcgggcggtggctgagatctctccggagaccgggccacggagagctggttctctgggcaacagcccgctgaaaacgtaagaggggtccaggcggcatcgtggtccacgcctgcctggctatgaacgggctgcccgcgactgagGCGCCGGGCGGCGCGGGCTGCGCTCTGGCCGGGCTCCCGCCGCTACCGCGCGGCCTCAGCGGCCTTCTTAACGCTAGTGGGGGCTCGTGGAGGGAGCTGGAGCGTGTCTACAGCCAACGGAGCCGCATCCACGACGAACTGAGTCGTGCCGCCCGCGCCCCGGATGGTCCTCGCCATGCCGCTGGATCTGCTAACTCAGGTTCTGCAGCGGGCCCGCGCCGCCCGGTTAACCTCGACTCTGCACTAGCCGCGCTGCGCAAGgagatggtgagtaggtgggcgcctcgccagggtagtagctctgaagagggcagaaataagtctgggatccgcttcctcatctcaggtccagcaggaagcatctggtcacggggctttaggacagcactgatagtaatgtgtagcaattg
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: AGCCGCGCTGCGCAAGGAGA and GCTGCCCGCGACTGAGGCGC. This resulted in a 261 bp deletion of Chr19:5,729,243-5,729,503(GRCm38/mm10) that removes exon ENSMUSE00000856419. Founder 13M
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 73526 | TGT CTA CAG CCA ACG GAG | Wild type Forward | A | |||
| 73527 | GAA CCT GAG TTA GCA GAT CC | Wild type Reverse | A | |||
| 73528 | Fluorophore-1 | ATC CAC GAC GAA CTG AGT C | Quencher-1 | WT Probe | ||
| 73529 | CTG CCT GGC TAT GAA CGG | Mutant Forward | A | |||
| 73530 | ACT TAT TTC TGC CCT CTT CA | Mutant Reverse | A | |||
| 73531 | Fluorophore-2 | AGA TGG TGA GTA GGT GGG CG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 73526 | 0.40 uM |
| 73527 | 0.40 uM |
| 73529 | 0.40 uM |
| 73530 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.