For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 108 bp
Wild Type = 118 bp
>chr2:38950922+38951039 118bp GACAGGAGATGGGAATGAAT AACGTTGTTCCCAGAGTAAA
Sequence
Wt Sequence (deletion in lower case):
CCCATAAACCAAGACCAGTGAGCGAGAGACAAGGCTAGGAGGTCTTCCAAAGAGCCAACAAAACAGGTGGACAGGAGATGGGAATGAATATGTAACCTACCggattgggtctcaagcctgcagagaaaatctgtatggagaaacagaatccaacaactatggatgattttactctgggaacaacgttacagacactgcgactacctccagctctcacacactgagctactgtgactggcagcccctcattttactgtcacccaaatctgacacttctattcttcccaggacacagctggagggcaaggcagagatctcaacaaatatggcagcatacagaagagcttctcagacaagggcctggcaaagcctcccaaggagaagctgctgaaagtggagaagctgaggaaggagagcatcaagggcagaataccccagcccacagccaggccacgtgcgctggctcagcagcaggcagtgatccgaggcttcacctactacaaggcaggcagacaggaggccagacaggaggccagacaggaggcacccaaggctgccgctggtgagtggaagggagccgggcctggttgacggatggctgcttccagagatccacctgccttcgaagcagccacaaagtcacagatctccgcatcactgtttagttttctagaatcctttgctcaaccatacACTGGGAAGAGGCCCACAGGCAGGGTTGCTAATGGGGAGAGAATAGAGGCCTCTCTTTCAGTACTTCAAGCCTCACCTTTTCTGCACTTCCTTTTATTCAACGACCTGCTGCAGGTCAGCTACAGACCAAGTGAC
This mutation is a 592 bp deletion of region Chr2:38,950,954-38,951,545 (GRCm38/mm10)
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 70979 | GAC AGG AGA TGG GAA TGA AT | Common | A | |||
| 70980 | AAC GTT GTT CCC AGA GTA AA | Wild type Reverse | A | |||
| 70981 | GTG AGG CTT GAA GTA CTG AA | Mutant Reverse | A | |||
| 70982 | Fluorophore-1 | TCT CAA GCC TGC AGA GAA A | Quencher-1 | WT Probe | ||
| 70983 | Fluorophore-2 | ACC TAC CAC TGG GAA GAG GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 70979 | 0.40 uM |
| 70980 | 0.40 uM |
| 70981 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.