For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
chr9:97365779-97365876 98bp CTCAACCTGTGCAACGACTG TTCTCATCCTGGTCCTCAGC
Mutant= 130 bp
Wild Type = 74 bp
Sequence
Wt Sequence (deletions in lower case):
ATGGGTACCAGTGCCTTAACTGAGTTCATTTACTAAGAGAGTAGAGGCAAGCCAAGACAGGCAccatgcaggaaccgtttatcacctttcctatgtgcaacccctctgggctggtccttctggagctcttgtgtattgttcctgaagcctgggcttgctttttctttcagctctaagaccgccctccgcgtggggagcagcgatactcagatggatgaacccaagaccatgcctgccagcagccacctggtgagccacctcacctgccccatgtgcaaccggctgcgcctgcactccttcatgctgccctgcaaccacagcctatgcgagaagtgcctgcggcagctgcaaaagcacgccgaggtcacggagaatttcttcatcctcatctgccccatgtgcagccgctcgcactgtatgccctacagccaccagatgcacctgccagaaaactacctgcgcgggcgccttactaaacgctacatgcagcagcacggctacctcaagtggcgcttcgaccgctcctcagggcccatcctctgccaggtgtgccgcacccggcgcattgcctacaagcgctgtgtcacctgtcgtctcaacctgtgcaacgactgtctcaaggccttccactcagacgtggccatgcaggaccacgtcttcgtggacaccagcgctgaggaccaggatgagaagatttgcatccaccatccatccagccgcatcaacgagtactgccgcagcgacaaccagctactctgcgctttctgcaagatcgctttccacaatggccatgacacggtcagcctcatagacgcctgctccgagaggtctgctgccctcttcagtgccatcgccaagttcaaagcaggtcccgatcagtttcctgctccccttcagtgtaactcccagctgtgaaaaagaccagaggatgctgtagggaaccttttgggggcaggttgtggggtggggtagggggaggtgctcaagctggtggagaaatctagacactggGAGAGCCTGAGATGGCCGCACAGGTATCCATGACAGCTATCACTGGCCAGTTAGTGTCTCTGTGACTCAG
This mutation is a 948 bp deletion beginning at Chromosome 9 position 97,365,460 bp and ending after 97,366,407 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 68229 | Fluorophore-1 | CCA AGA CAG GCA GAG AGC CTG AGA | Quencher-1 | MUT Probe | ||
| 68230 | TGA GTC ACA GAG ACA CTA ACT GG | Mutant Reverse | A | |||
| 68231 | GGG TAC CAG TGC CTT AAC TGA | Mutant Forward | A | |||
| 68690 | Fluorophore-2 | CAG CCG CTC GCA CTG TAT G | Quencher-2 | WT Probe | ||
| 68691 | ACG GAG AAT TTC TTC ATC CT | Wild type Forward | A | |||
| 68692 | TGC ATC TGG TGG CTG TAG | Wild type Reverse | A |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 68230 | 0.40 uM |
| 68231 | 0.40 uM |
| 68691 | 0.40 uM |
| 68692 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.