For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:102166938-102167034 97bp GCTGTTGGACAAAAGGCTTC CCACATCTCTGGATGCCAAT
Mutant= 96 bp
Wild Type = 97 bp
Sequence
Wt Sequence gctgttggacaaaaggcttctgggtggttgtcttgctgaaagtgtaccagggcAgcgagggtagctgttggcagcttattggcatccagagatgtgg
Mut Sequence: gccttgtgttttcacgctctctttgggatgaatctctaacgtagcacagtaCAgcgagggtagctgttggcagcttattggcatccagagatgtgg
A 452 bp deletion beginning at Chromosome 11 position 102,166,982 bp and ending after 102,167,433 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 68546 | CCA CAT CTC TGG ATG CCA AT | Common | A | |||
| 68547 | GCT GTT GGA CAA AAG GCT TC | Wild type Forward | A | |||
| 68548 | GCC TTG TGT TTT CAC GCT CT | Mutant Forward | A | |||
| 68549 | Fluorophore-1 | TAG CAC AGT ACA GCG AGG GTA GC | Quencher-1 | MUT Probe | ||
| 68550 | Fluorophore-2 | TGG TTG TCT TGC TGA AAG TGT ACC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 68546 | 0.40 uM |
| 68547 | 0.40 uM |
| 68548 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.