For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 109 bp
Wild Type = 98 bp
chr11:97038775+97038872 98bp TTGCAGGTAGAGGCTGTGAA CTCTCGGTGAACTGGAGACTG
Sequence
Wt Sequence (deletions in lower case)
CTAGGAAAGCTGCTCTTGTTCCGAATCTCCAGGAAGCATGGACAGCCACctagcagctttccagaaggcccctgtcagcttgtgcttggctttctccgcgccaccactggagagccacgtgtctgagaccagccagtctcatgacttagactggtgtcacgaagctgtccttgacatctcaaagccactcagcccttaccctcttcctttccttgagtgagacacgtctcctcttccctccctcccatcatctattgaagaccacaggtgtgaaccctgtttactctcctctaggtttcacactctcggtgaactggagactgtccgcctggacggggaagggattacttgtatcgggaatttagagaaactccggaatattcacagcctctacctgcaatcggtaaagtctcccccacccccagcacacgcgcacacgcacacacactcatgcttcctgtcctttccctgctgtgaacCTAGTTTGTCTAATCTGAAAACAGCTGAACAGCTCATCCTTGCGTTTCTGGTGTTTTGGCCAGGAGAACAT
This mutation is a 430 bp deletion beginning at Chromosome 11 position 97,038,696 bp and ending after 97,039,125 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 67959 | AAG CTG CTC TTG TTC CGA AT | Mutant Reverse | A | |||
| 67960 | CTC CTG GCC AAA ACA CCA G | Mutant Forward | A | |||
| 67961 | CTC TCG GTG AAC TGG AGA CTG | Wild type Reverse | A | |||
| 67962 | TTG CAG GTA GAG GCT GTG AA | Wild type Forward | A | |||
| 67963 | Fluorophore-1 | AAC AGC TGA ACA GCT CAT CCT TGC G | Quencher-1 | MUT Probe | ||
| 67964 | Fluorophore-2 | CCG ATA CAA GTA ATC CCT TCC C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 67959 | 0.40 uM |
| 67960 | 0.40 uM |
| 67961 | 0.40 uM |
| 67962 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.