For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 113 bp
Wild Type = 110 bp
chr7:102098070+102098179 110bp GTGAAGACTGCCCACACCTC TCAAGGCCCTGCATTTCTAC
Sequence
Wt Sequence (deletions in lower case):
CACAAACCCATGGCTGTCCGACTCCATTGCCTGTGTTATTTGTGTCTGTTTCGGATCCTGCCAATTgcatgcatcagctatgtcgcacagaaatgaaaacctgtccccagcagtccctggccagtgttttaaacttacactttggcctctgtggcacctcccttgtgtccataggttcgagctgttcctatcctgcccctgagcctggttccagatacctttgatgatgcctatgtgggctgctctgaggagatggaggagaaagcaggcctgctgctaaaggaagagatggcacgccatgccctgctgcgggaatcctgggaagcagcacaagaggcctgggcacaccggcgtcacaagctcactctacctcctggcttcaaagcccagcacggagtagcgattatggtgtacaccaactcatccaacaccttgtactgggagctgaaccaggccgtacggacaggaggtggctcccgggagctctacatgaggcacttccccttcaaggccctgcatttctacttgacccgggctctgcagctgctgcggggctctggagggtgcagtaggggacctggggaggtggtgttccgaggtgtgggcagtcttcactttgaacccaagaggctgggggactctgtccgattaggacagtttacctccagctctgtggatgagagagtggctcgcaggtttgggaatgccaccttcttcaatctaaggacttgttttggggctcctatccaggcgttgtctgtcttccctgaggagcgtgaggtgctgatacccccacacgaagtcttcttggtcactgggttctcccaggatggagcccagagcatagtgactctctggagttatgatcagacctgcagccactttaactgcgcctatttgggtggtgagcgatgaatgggagacagagaatggcagggtgggtgaaagaagccagtgtattctgacccagtccccagagccttcaggaaccacttggttagtgagattggggctccaccaggtcctgggagagttcaagatctgtggacatcctcagatgactgtcttctcaaaaggtcctctgtagtacctcgtAGACCAAGGAACAGCGAGAAGGAGGCAATATTGCTTCCGGTCTCAGTAGGCTCTGACTTGATGGGGCTA
This mutation is a 1029 bp deletion beginning at Chromosome 7 position 102,097,590 bp and ending after 102,098,618 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 66920 | TCA AGG CCC TGC ATT TCT AC | Wild type Reverse | A | |||
| 66921 | GTG AAG ACT GCC CAC ACC TC | Wild type Forward | A | |||
| 66922 | CGA CTC CAT TGC CTG TGT TA | Mutant Reverse | A | |||
| 66923 | CCC ATC AAG TCA GAG CCT AC | Mutant Forward | A | |||
| 66924 | Fluorophore-1 | CAG CGA GAA GGA GGC AAT ATT GC | Quencher-1 | MUT Probe | ||
| 66925 | Fluorophore-2 | TAC TGC ACC CTC CAG AGC C | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 66920 | 0.40 uM |
| 66921 | 0.40 uM |
| 66922 | 0.40 uM |
| 66923 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.