For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 100 bp
Wild Type = 122 bp
>chr14:20077556-20077677 122bp CCGTTCTTACTTCTGTTTGTTTCTG TTCAAGAAGGTGATGTTAGTCAGG |
Sequence
Wt Sequence (deletions in lower case):
CCGTTCTTACTTCTGTTTGTTTCTGTGTTTTAGGAAGCAGGCCAGCAGCTCCCTGAGagcacagcagtccctctgccttcctcctgccgccagtctttcctgactaacatcaccttcttgaaggttctcctctggttggtcctgctgggactgtttgtggaactggaatttggtctggcttattttgtcctgtccatgttctattggatgtatgtagggactcggggtcccgaggagaagaaagaaggggagaagagcgcctactctgtgttcaacccgggctgtgaagccatccagggcacgctgactgctgagcagctggagcaagagttacagctcagaccccctcagggaagtaggaccagccccagctgttCCTCCTATCCTTGAACGTGGACTTTAGAGGACAAAGGACAGCT
This mutation is a 319 bp deletion beginning at Chromosome 14 position 20,077,302 bp and ending after 20,077,620 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64298 | CCG TTC TTA CTT CTG TTT GTT TCT G | Common | A | |||
| 64299 | TTC AAG AAG GTG ATG TTA GTC AGG | Wild type Reverse | A | |||
| 64300 | Fluorophore-1 | AGC ACA GCA GTC CCT CTG C | Quencher-1 | WT Probe | ||
| 64301 | AGC TGT CCT TTG TCC TCT AAA GTC | Mutant Reverse | A | |||
| 65945 | Fluorophore-2 | AGC TCC CTG AGC CTC CTA TCC TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64298 | 0.40 uM |
| 64299 | 0.40 uM |
| 64301 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.