Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 108 bp
Wild Type = 120 bp
>chr11:68892243+68892362 120bp TGCTTGTCATAGCTGTGGTG CTCTCCTGAGACTGGCATCA
Large deletion: Mutant sequence with junction in uppercase
tgcttgtcatagctgtggtgaggcatcaggcacttcaggtatccatcCcactccacacacttcctacccaacccgaGGaaaggacagagaaattgatgggatggaaga
This mutation is a 3534 bp deletion beginning at Chromosome 11 position 68,892,320 bp and ending after 68,895,853 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64284 | TGC TTG TCA TAG CTG TGG TG | Common | A | |||
| 64285 | CTC TCC TGA GAC TGG CAT CA | Wild type Reverse | A | |||
| 64286 | TCT TCC ATC CCA TCA ATT TC | Mutant Reverse | A | |||
| 64288 | Fluorophore-1 | CCA ACC CGA GGA AAG GAC AG | Quencher-1 | MUT Probe | ||
| 65800 | Fluorophore-2 | CAC TGC TGG GAT GTC CTG TT | Quencher-2 | WT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64284 | 0.40 uM |
| 64285 | 0.40 uM |
| 64286 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.