For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 94 bp
Wild Type = 92 bp
>chr7:92568336+92568427 92bp AGGAATTGCAGAGTGCGTTT AAGAGACAGCTAACAAGCTTCCA |
Sequence
Wt Sequence (deletions in lower case):
AGGAATTGCAGAGTGCGTTTAAAATCCGATAGCATTgtccatcttttccttgtgtaacagtggagctattggaagcttgttagctgtctcttgctactgatgtacacgttttaaatgcagatttccttgtatacaggatttgacaaaacacaagcacagacaattgtatcagtgctaagtacgctatcaaacgtcagcctggatactatctacaaggagatggtgactaaagctcagcaggtaatacattcattttcttctctctcctgatagtctcattacatcatctctttcaaggaaggaggaaaggacaaattagaaaggcctttctcagcatctgtctagaagagttggagtgtccctacaagagtacttggtacctagagtgggattcattcatcttcccctgtgtgagataaatggagtgttttggtcatggtggtagactgagagaaacaactttcccctgggaagctcTCCAAAGTAAAAGAGCTAGCCTTTCAATATGATGTGTCTACTGTTTTCATGGGTTGCGCCATGGTTAATCTT
This mutation is a 441 bp deletion beginning at Chromosome 7 position 92,568,372 bp and ending after 92,568,812 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64318 | AGG AAT TGC AGA GTG CGT TT | Common | A | |||
| 64319 | AAG AGA CAG CTA ACA AGC TTC CA | Wild type Reverse | A | |||
| 64321 | Fluorophore-1 | TCC ATC TTT TCC TTG TGT AAC AGT G | Quencher-1 | WT Probe | ||
| 65394 | AAG ATT AAC CAT GGC GCA AC | Mutant Reverse | A | |||
| 65395 | Fluorophore-2 | CCG ATA GCA TTT CCA AAG TAA AAG AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64318 | 0.40 uM |
| 64319 | 0.40 uM |
| 65394 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.