For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 121 bp
Wild Type = 117 bp
>chr1:121441552+121441668 117bp AAGGAAAGAAGGCAATAGGTG CAGACCTGACCAAGTTCATCC
Sequence
Wt Sequence (deletions in lower case):
AAGGAAAGAAGGCAATAGGTGTAATACATGATGGGAAGAATCctttgtgaccttacatgcatgtagctgaattgtgcttctcatgttggtctactgggatgaacttggtcaggtctgtcactgtcaccctgaccaggctgggacttcttcacagttctgcctagactttagagctgtctttagaaccactcagtgtgtcctgactctgcttactgttttcttctggacagtgctctatcggaaaagattgtctccgtcctcccaaggatgaagtgtccccaccagctggagccccaccagatccagggcatggattttatccacatattccctgtcgtgcaggtgagggcttctgcgtggattcttgcctCTTAACTGGGAGTTCCTGGAACACACCTGGCTCTCACAGCCCAGCCTGGACCCAGGCTGTAGTGTGGGATGGGTCTGGG
This mutation is a 328 bp deletion beginning at Chromosome 1 position 121,441,594 bp and ending after 121,441,921 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65363 | AAG GAA AGA AGG CAA TAG GTG | Common | A | |||
| 65364 | CAG ACC TGA CCA AGT TCA TCC | Wild type Reverse | A | |||
| 65365 | CCC AGA CCC ATC CCA CAC | Mutant Reverse | A | |||
| 65366 | Fluorophore-1 | AGA ATC CTT TGT GAC CTT ACA TGC | Quencher-1 | WT Probe | ||
| 65367 | Fluorophore-2 | ATG GGA AGA ATC CTT AAC TGG GAG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65363 | 0.40 uM |
| 65364 | 0.40 uM |
| 65365 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.