Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
Mutant= 111 bp
Wild Type = 100 bp
>chr7:27354755-27354854 100bp TTTCTCCTTGCAATGTGCTG TCATGGAGGAGGCTGGAA |
Large deletion: Mutant sequence with junction in uppercase:
tttctccttgcaatgtgctgttcatgcctatgccctagAGgggatgggaattctgtacagagtcagtctttttgccttgtgagAAatgtGttagaccttcagaactctgca
This mutation is a 3202 bp deletion beginning at Chromosome 7 position 27,351,614 bp and ending after 27,354,815 bp (GRCm38/mm10).
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 65048 | TTT CTC CTT GCA ATG TGC TG | Common | A | |||
| 65049 | TCA TGG AGG AGG CTG GAA | Wild type Reverse | A | |||
| 65050 | TGC AGA GTT CTG AAG GTC TAA CA | Mutant Reverse | A | |||
| 65051 | Fluorophore-1 | CCT ATT ACC CAG GGG TGT CCA T | Quencher-1 | WT Probe | ||
| 65052 | Fluorophore-2 | ATG CCC TAG AGG GGA TGG GA | Quencher-2 | MUT Probe |
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 65048 | 0.40 uM |
| 65049 | 0.40 uM |
| 65050 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
We use cookies to personalize our website and to analyze web traffic to improve the user experience. You may decline these cookies although certain areas of the site may not function without them. Please refer to our privacy policy for more information.