For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
Mutant= 110 bp
Wild Type = 105 bp
>chr14:62673985+62674089 105bp CACAAAGAGCCTGAACCCTA TCTCCCACAGAGTCTTAGTCAGG |
Sequence
Wt Sequence (deletions in lower case):
CACAAAGAGCCTGAACCCTAAAAAGCTCAGACTGGATGGCTCCCTAAGacacggaccccagcaggttcagcagctgtggatccctgactaagactctgtgggagatctcagagagctttaggaacactaaagcagccatgtcacccaatagttcccagtctcagattgcttcctgaggctgaggaggacaccctcttactgttgctgtcatgtaagtctgctttctccaagttgtagtactgttgagtttctctggctcctaggacaaagctaattcctaacccactaaatccctaggccagttccaggatgctgcaggccatgagatagctgttctagagctgttgtacctgggaagggtggccagtttgctcctggtgcttccccaagacaagggcactcctctggaccacattgaaccacacctcactgccagagtcctccacctctggaccacaaggctgaagagagccagaatggatgtgtttctccccaggtgagtggagacatcttccttatggaacaattaccatgttatccagtgaggcttgcacttagagccaagtggtcagactcaaagtccatccttccactggactaccttgtcaaatgagctttaaccaaggagaggttccctggagTTTGAGTCTATTCTAAAATCACTAAAGACTAGTTCACTACACATGCACAGTTGAATTCCTGG
This mutation is a 593 bp deletion beginning at Chromosome 14 position 62,674,033 bp and ending after 62,674,625 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 64289 | CAC AAA GAG CCT GAA CCC TA | Common | A | |||
| 64290 | TCT CCC ACA GAG TCT TAG TCA GG | Wild type Reverse | A | |||
| 64291 | CCA GGA ATT CAA CTG TGC AT | Mutant Reverse | A | |||
| 64292 | Fluorophore-1 | CCA GCA GGT TCA GCA GCT | Quencher-1 | WT Probe | ||
| 64293 | Fluorophore-2 | ATG GCT CCC TAA GTT TGA GTC TAT TC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 64289 | 0.40 uM |
| 64290 | 0.40 uM |
| 64291 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.